TP53 Pathway Lentivirus

P53 Signal Pathway: Tumor protein p53 (TP53) is crossroad of a network of signaling pathways that are essential for cell growth regulation and apoptosis induced by genotoxic and non-genotoxic stresses. The p53 tetramer recognizes specifically a 20-bp DNA of p53 response elements (p53-RE). There are hundreds of experimental verified p53 response elements. The activation of p53 is a two steps process. First p53 protein level is increased via the inhibition of its interaction with mdm2 and the other negative regulators. Second, a series of modulator (kinases, acetylases) will activates p53 transcription. The accumulated P53 binds to p53-RE which regulates downstream target gene expression, resulted in either cell cycle arrest and DNA repair or apoptosis. p53 becomes activated in response to myriad stressors, including but not limited to DNA damage, oxidative stress, osmotic shock, ribonucleotide depletion, and deregulated oncogene expression.

GenTarget developed a set of reporting lentivirus to monitor the activity P53-regulated signal transduction pathways in cultured cells. Those reporting lentivirus has a luminescent report or a fluorescent report under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of a few most potent P53 transcriptional response element (p53-RE) sequence motif (5′- GGGCATGTCCGGGCATGTCC, GAACATGTCCCAACATGTTG, GGACATGCCCGGGCATGTCT). When p53 binds to p53-RE sequence, the downstream reporter is expressed as the result of activation for the minimal promoter. This pathway lentivirus can be verified by stimulation from many chemicals, such as Nutlin (known as MDM-2 antagonist). The reporter’s signal can be easily and rapidly readout via plate assays (luciferase assay or by fluorescent microscope or FACS sorter).

Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or  provides internal reference for virus transduction efficiency when a fluorescent marker is under the RSV promoter. See lentivector core scheme below.

p53 scheme P53 GFP (Bsd)  lentivirus

The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of P53 signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.

Click the Product Manual (pdf) for all available Products for this pathway reporter.

Showing 1–10 of 36 results