Skip to content

For product queries: Call 1-858-265-6446 or email at info@gentarget.com

| Login / Register | 0 items | $0.00

gentarget inc.

7930 Arjons Drive, Suite B
San Diego, CA 92126
United States

  • Home
  • Products
    • Premade Lentivirus
      • cDNA (ORF) Expression
      • Luciferases Lentivirus
      • Fluorescent Markers
      • Sub-cellular Imaging
      • Nano-Lantern Imaging
      • Cytoskeleton Imaging
      • Unstable GFP
      • near-infrared RFP
      • Fluorescent fusion
      • CRE recombinase
      • CRE, Flp ColorSwtich
      • SEAP Reporter
      • Tet Repressor
      • rtTA Expression
      • lacZ Enzyme
      • iPS stem cell factors
      • Other enzyme
    • Premade AAV Virus
    • Premade Adenovirus
      • Common Markers & Enzymes
      • GFP CFP YFP RFP BFP & Controls
      • iPS Stem Cell Factors
      • ORF Expression
    • Pathway Reporter
      • Androgen Pathway
      • Antioxidant Pathway
      • ATF6 Pathway
      • C/EBP Pathway
      • CD44CR1 Pathway
      • c-Myc Pathway
      • CREB (cAMP-PKA) Pathway
      • E2F Pathway
      • EGR1 Promoter Pathway
      • Estrogen Receptor Pathway
      • FOXO Pathway
      • GATA Pathway
      • Glucocorticoid Pathway
      • Hedgehog Pathway
      • HNF4 Pathway
      • Hypoxia Pathway
      • IRF Pathway
      • JAK-STAT Pathway
      • JNK / AP1 Pathway
      • MAPK/ERK Pathway
      • MEF2 Pathway
      • MTF1 Pathway
      • NFAT Pathway
      • Notch Signal Pathway
      • NFκB Pathway
      • PPAR Pathway
      • Progesterone Pathway
      • RAR Pathway
      • STAT3 Pathway
      • TGF-β Pathway
      • TP53 Pathway
      • Wnt Signal pathway
      • XBP1 Pathway
      • Blue light inducible reporter
      • Heat inducible expression
      • Mitochondrial pH-sensitive probe
      • Signal Pathway Control
    • Cell Immortalization
      • hTERT Expression
      • SV40 Large T antigen
      • Knockdown P53 shRNA Lentivirus
      • Other Immortalization Factors
    • CARs and TCRs
      • CAR-T Lentivirus
      • TCR Lentivirus
      • Cell Antigens & Receptors
    • CRISPR Gene Editing
      • SpCas9 and SaCas9 Expression
      • Epigenomic: CRISPRi and CRISPRa
      • gRNA Lentivirus
      • CRISPR Repair and KnockIn
      • CRISPR KnockOut
    • Stable cell lines
      • Assay Cell Lines
      • Luciferase cells
      • Fluorescent cells
      • CRE and Flp reporting cells
      • CRE Expression Cells
      • CRISPR ready cell lines
      • TetR stable cells
      • rtTA stable cells
      • Inducible expression cell lines
      • Ion Channel cells
      • LacZ stable cells
      • Other stable cells
    • Cell-Specific Reporter
      • Astrocytes Report
      • B-Cell Reporter
      • Brain Cell Report
      • Cancer Specific Report
      • Endothelial Cell Report
      • Hematopoietic Cell Report
      • Hepatoma Cell Report
      • Kidney Cell Report
      • Leukocytes Report
      • Lung Tissue Report
      • Macrophages Report
      • Megakaryocytes Report
      • Monocytes Report
      • Muscle Cell Report
      • Neuron Report
      • Ovarian Cancer Report
      • Pancreatic Cancer Report
      • Prostate Cell Report
      • Stem Cell Report
    • Infectious Antigens
      • Viral Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
      • Validated shRNA Lentivirus
      • Customized shRNA
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
      • CRISPR gRNA lentivectors
      • shRNA Lentivectors
      • Promoter-less Lentivectors
      • Lentivirus Packaging plasmids
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
      • Optional Inducible Lentiviral System
      • SureTiter™ Lentiviral System
      • Enhanced super CMV promoter
      • InTag™ trans-membrane proteins
      • Fusion in vivo, Eco™ PCR Cloning
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News
Home / Pathway Reporter / Antioxidant Pathway

Antioxidant Pathway

About Antioxidant Pathway:

A major mechanism in the cellular defense against oxidative or electrophilic stress is activation of the Nrf1/Nrf2-antioxidant response signaling pathway, which regulates the expression of genes (antioxidant proteins) involved in protecting cells from oxidative damage.

Nrf2 (NF-E2-related factor 2) is ubiquitously expressed in most tissues and is continuously degraded in the cytosol under normal oxygen conditions via its inhibitor Keap1. Keap1 contains several cysteine residues that act as redox sensors. Upon changes in the cellular oxygen environment, these cysteine residues are oxidised. As a result, Keap1 undergoes a conformational change and releases Nrf2, which is translocated into the nucleus. In the nucleus, Nrf2 forms a heterodimer with small maf proteins and binds to Nrf1/Nrf2 Response Element, antioxidant response element (ARE) that found in the promoter regions of many antioxidant enzymes, including thioredoxin and thioredoxin reductase, up-regulating their expression.

How to Detect Antioxidant Pathway:

GenTarget developed a set of reporting lentivirus to monitor the transcriptional activity of the antioxidant pathway. Those reporting lentivirus has a luminescent report (Luciferase, Renilla Luc) or a fluorescent report (GFP, RFP) or a  secreted SEAP report,  under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of Nrf1/Nrf2 Response Element or ” antioxidant response element” (ARE) sequence motif (5′- TCACAGTGACTCAGCAAAATT). When Nrf2 / Nrf1 binds to Nrf2-RE sequence, the downstream reporter is expressed as the result of activation for the minimal promoter. This pathway can be verified by DL-Sulforaphane stimulation.

The luciferase signal can be measured via Luciferase assay. The fluorescent reporter can be detected via its fluorescent signal. The SEAP secreted into cell culture supernatant, which allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.

Pathway Report Lentivirus Product Features:

Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or  provides internal reference for virus transduction efficiency when a fluorescent marker is under the RSV promoter. See lentivector core scheme below.

Antioxidant pathway lentivector map

The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of Antioxidant signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.

Click the Product Manual (pdf) for all available products for this pathway reporter.

NameSKUPriceBuy
ARE-GFP (Bsd) lentivirus in PBSLVP981-B-PBS$650.00
ARE-GFP (Neo) lentivirus in PBSLVP981-N-PBS$650.00
ARE-GFP (Puro) lentivirus in PBSLVP981-P-PBS$650.00
ARE-GFP (RFP) lentivirus in PBSLVP981-R-PBS$650.00
ARE-Luc (Bsd) lentivirusLVP983-B$495.00
ARE-Luc (Bsd) lentivirus in PBSLVP983-B-PBS$650.00
ARE-Luc (GFP) lentivirusLVP983-G$495.00
ARE-Luc (GFP) lentivirus in PBSLVP983-G-PBS$650.00
ARE-Luc (Neo) lentivirusLVP983-N$495.00
ARE-Luc (Neo) lentivirus in PBSLVP983-N-PBS$650.00
ARE-Luc (Puro) lentivirusLVP983-P$495.00
ARE-Luc (Puro) lentivirus in PBSLVP983-P-PBS$650.00
ARE-Luc (RFP) lentivirusLVP983-R$495.00
ARE-Luc (RFP) lentivirus in PBSLVP983-R-PBS$650.00
ARE-RFP (Bsd) lentivirus in PBSLVP982-B-PBS$650.00
ARE-RFP (GFP) lentivirus in PBSLVP982-G-PBS$650.00
ARE-RFP (Neo) lentivirus in PBSLVP982-N-PBS$650.00
ARE-RFP (Puro) lentivirus in PBSLVP982-P-PBS$650.00
ARE-RLuc (Bsd) lentivirus in PBSLVP984-B-PBS$650.00
ARE-RLuc (GFP) lentivirus in PBSLVP984-G-PBS$650.00
ARE-RLuc (Neo) lentivirus in PBSLVP984-N-PBS$650.00
ARE-RLuc (Puro) lentivirus in PBSLVP984-P-PBS$650.00
ARE-RLuc (RFP) lentivirus in PBSLVP984-R-PBS$650.00
ARE-SEAP (Bsd) lentivirusLVP1245$495.00
ARE-SEAP (Bsd) lentivirus in PBSLVP1245-PBS$650.00
ARE-SEAP (Neo) lentivirusLVP1246$495.00
ARE-SEAP (Neo) lentivirus in PBSLVP1246-PBS$650.00
ARE-SEAP (Puro) lentivirusLVP1244$495.00
ARE-SEAP (Puro) lentivirus in PBSLVP1244-PBS$650.00
ARE-SEAP (RFP) lentivirusLVP1247$495.00
ARE-SEAP (RFP) lentivirus in PBSLVP1247-PBS$650.00

    Cart

    Product Selection Guides

    • Luciferase Imaging
    • Cell Immortalization
    • Signal Pathway Assay
    • cDNA (ORF) Expression
    • CAR-T, TCR and More
    • CRISPR, CRISPRa, CRISPRi
    • Sub-cellular Imaging
    • Reporter Cell Lines
    • Premade Lentivirus
    • Promoter Research
    • Lentivirus & Cell Line Services

    VIEW MORE

    Stay Connected

    Online Payment Service
  • Home
  • Products
    • Premade Lentivirus
    • Premade AAV Virus
    • Premade Adenovirus
    • Pathway Reporter
    • Cell Immortalization
    • CARs and TCRs
    • CRISPR Gene Editing
    • Stable cell lines
    • Cell-Specific Reporter
    • Infectious Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News

2008 ~ ©, 2025 GenTarget Inc. All rights reserved.

Contact | Terms | View Cart

Scroll Up