Skip to content

For product queries: Call 1-858-265-6446 or email at info@gentarget.com

| Login / Register | 0 items | $0.00

gentarget inc.

7930 Arjons Drive, Suite B
San Diego, CA 92126
United States

  • Home
  • Products
    • Premade Lentivirus
      • cDNA (ORF) Expression
      • Luciferases Lentivirus
      • Fluorescent Markers
      • Sub-cellular Imaging
      • Nano-Lantern Imaging
      • Cytoskeleton Imaging
      • Unstable GFP
      • near-infrared RFP
      • Fluorescent fusion
      • CRE recombinase
      • LoxP GFP/RFP ColorSwtich
      • SEAP Reporter
      • Tet Repressor
      • rtTA Expression
      • lacZ Enzyme
      • iPS stem cell factors
      • Other enzyme
    • Pathway Reporter
      • Androgen Pathway
      • Antioxidant Pathway
      • C/EBP Pathway
      • CD44CR1 Pathway
      • CREB (cAMP-PKA) Pathway
      • EGR1 Promoter Pathway
      • Estrogen Receptor Pathway
      • Glucocorticoid Pathway
      • Hedgehog Pathway
      • Hypoxia Pathway
      • JAK-STAT Pathway
      • JNK / AP1 Pathway
      • MAPK/ERK Pathway
      • Notch Signal Pathway
      • NFκB Pathway
      • TP53 Pathway
      • Wnt Signal pathway
      • Blue light inducible reporter
      • Heat inducible expression
      • Mitochondrial pH-sensitive probe
      • Signal Pathway Control
    • Cell Immortalization
      • hTERT Expression
      • SV40 Large T antigen
      • P53 siRNA Lentivirus
      • Other Immortalization Factors
    • ImmunoOncology Research
      • CAR-T and More
      • Assay Cell Lines
      • Cell Antigens & Receptors
    • CRISPR Gene Editing
      • Cas9 Expression
      • Epigenomic: CRISPRi and CRISPRa
      • gRNA Lentivirus
      • CRISPR Repair & KnockIn
      • CRISPR KnockOut
    • Stable cell lines
      • Pathway Cell Line
      • Luciferase cells
      • Fluorescent cells
      • CRE reporting cells
      • CRE Expression Cells
      • CRISPR ready cell lines
      • TetR stable cells
      • rtTA stable cells
      • Inducible expression cell lines
      • Ion Channel cells
      • LacZ stable cells
      • Other stable cells
    • Cell-Specific Reporter
      • Astrocytes Report
      • B-Cell Reporter
      • Brain Cell Report
      • Cancer Specific Report
      • Endothelial Cell Report
      • Hematopoietic Cell Report
      • Hepatoma Cell Report
      • Kidney Cell Report
      • Leukocytes Report
      • Lung Tissue Report
      • Macrophages Report
      • Megakaryocytes Report
      • Monocytes Report
      • Muscle Cell Report
      • Neuron Report
      • Ovarian Cancer Report
      • Pancreatic Cancer Report
      • Prostate Cell Report
      • Stem Cell Report
    • Infectious Antigens
      • Viral Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • Adenovirus
      • Common Markers & Enzymes
      • GFP CFP YFP RFP BFP & Controls
      • iPS Stem Cell Factors
      • ORF Expression
    • shRNA lentivirus
      • Validated shRNA Lentivirus
      • Customized shRNA
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
      • CRISPR gRNA lentivectors
      • shRNA Lentivectors
      • Promoter-less Lentivectors
      • Lentivirus Packaging plasmids
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Technology
      • Optional Inducible Lentiviral System
      • SureTiter™ Lentiviral System
      • Enhanced super CMV promoter
      • InTag™ trans-membrane proteins
      • Fusion in vivo, Eco™ PCR Cloning
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Product citations
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News
Home / Premade Lentivirus / CRE recombinase

CRE recombinase

About CRE Recombinase:

CRE Recombinase  (click to see its codon sequence), from bacteriophage P1, catalyzes recombination between two LoxP sites (5′- GAAGTTCCTATTCTGTATTTATACGAAGTTAT -3′). Purified CRE enzyme can join individual plasmids containing lox sites.

CRE Expression Lentivirus:

GenTarget provides premade CRE expression lentivirus that can catalyze the joining of lox sites  in vivo. with following features.

  1. Those lentivirus contain the nuclear localization signal (NLS), PKKKRKV from the SV40 Large T-antigen at its N-terminus, allowing penetration of the nuclear membrane and thereby increasing the number of in vivo recombination events.
  2. CRE is expressed under an optional inducible CMV promoter (TetCMV), or an enhanced EF1a promoter, or a CAG promoter to best fit different cell type.
  3. The CRE Expression Lentivirus also a fluorescent or antibiotic selection, or fluorescent-antibiotic fusion dual selection. 
  4. Gentarget also provides CRE, luciferase, and fluorescent marker (GFP/RFP) triple-labeled lentivirus.

See the  lentivector structure diagrams below:

CRE expression lentivector schemes

CRE-lentivirus-map-scheme

Lentivirus are provided as  in two formats:

  1. Crude Lentivirus: 200ul /vial in DMEM containing 10 x Polybrene;
  2. Concentrated lentivirus: 200ul PBS solution which is better for hard-to-transduced cell types or for serum-free culture.

Note: Ultra-concentrated virus (>= 109 IFU/ml) is available upon special requests.

Please see each Product Manual below for details.

NameSKUPriceBuy
CMV-Luciferase-2A-CRE (GFP-Bsd), Concentrated LentivirusLVP411-PBS$800.00
CMV-Luciferase-2A-CRE (GFP-Puro), Concentrated LentivirusLVP412-PBS$800.00
CMV-Luciferase-2A-CRE (RFP-Bsd), Concentrated LentivirusLVP413-PBS$800.00
CMV-Luciferase-2A-CRE (RFP-Puro), Concentrated LentivirusLVP414-PBS$800.00
CRE (CAG promoter, Bsd) lentivirusLVP574$350.00
CRE (CAG promoter, Bsd), Concentrated LentivirusLVP574-PBS$650.00
CRE (CAG promoter, Neo) lentivirusLVP575$350.00
CRE (CAG promoter, Neo), Concentrated LentivirusLVP575-PBS$650.00
CRE (CAG Promoter, Puro) LentivirusLVP573$350.00
CRE (CAG promoter, Puro), Concentrated LentivirusLVP573-PBS$650.00
CRE (CMV Pro, Bsd), Concentrated LentivirusLVP336-PBS$650.00
CRE (CMV promoter, Bsd) Expression LentivirusLVP336$350.00
CRE (CMV Promoter, Neo) lentivirusLVP297$350.00
CRE (CMV Promoter, Neo), Concentrated LentivirusLVP297-PBS$650.00
CRE (CMV Promoter, Puro) LentivirusLVP339$350.00
CRE (CMV Promoter, Puro), Concentrated LentivirusLVP339-PBS$650.00
CRE (EF1a Promoter, Bsd) lentivirusLVP519$350.00
CRE (EF1a Promoter, Bsd), Concentrated LentivirusLVP519-PBS$650.00
CRE (EF1a Promoter, Neo) lentivirusLVP521$350.00
CRE (EF1a Promoter, Neo), Concentrated LentivirusLVP521-PBS$650.00
CRE (EF1a Promoter, Puro) lentivirusLVP520$350.00
CRE (EF1a Promoter, Puro), Concentrated LentivirusLVP520-PBS$650.00
CRE (GFP-Puro) (CAG Promoter) lentivirusLVP576$350.00
CRE (GFP-Puro) (CAG Promoter), Concentrated lentivirusLVP576-PBS$650.00
CRE (RFP-Bsd) (CAG Promoter) lentivirusLVP577$350.00
CRE (RFP-Bsd), (CAG Promoter), Concentrated lentivirusLVP577-PBS$650.00
CRE (RFP-Puro) (CAG Promoter) lentivirusLVP578$350.00
CRE (RFP-Puro), (CAG Promoter), Concentrated lentivirusLVP578-PBS$650.00
CRE-2A- RFP (CMV promoter), Concentrated LentivirusLVP805-PBS$650.00
CRE-2A- RFP(CMV promoter) LentivirusLVP805$350.00
CRE-2A-GFP (CMV promoter) LentivirusLVP804$350.00
CRE-2A-GFP (CMV, Bsd) Concentrated LentivirusLVP337-PBS$650.00
CRE-2A-GFP (CMV, Bsd) lentivirusLVP337$350.00
CRE-2A-GFP (CMV, Neo) CMV lentivirusLVP408$350.00
CRE-2A-GFP (CMV, Neo), Concentrated LentivirusLVP408-PBS$650.00
CRE-2A-GFP (CMV, Puro) lentivirusLVP407$350.00
CRE-2A-GFP (CMV, Puro), Concentrated LentivirusLVP407-PBS$650.00
CRE-2A-GFP (EF1a Pro, Bsd) lentivirusLVP525$350.00
CRE-2A-GFP (EF1a Pro, Bsd), Concentrated LentivirusLVP525-PBS$650.00
CRE-2A-GFP (EF1a Pro, Neo) lentivirusLVP527$350.00
CRE-2A-GFP (EF1a Pro, Neo), Concentrated LentivirusLVP527-PBS$650.00
CRE-2A-GFP (EF1a Pro, Puro) lentivirusLVP526$350.00
CRE-2A-GFP (EF1a Pro, Puro), Concentrated LentivirusLVP526-PBS$650.00
CRE-2A-GFP(CMV promoter), Concentrated LentivirusLVP804-PBS$650.00
CRE-2A-RFP (CMV, Bsd) lentivirusLVP013$350.00
CRE-2A-RFP (CMV, Bsd), Concentrated LentivirusLVP013-PBS$650.00
CRE-2A-RFP (CMV, Neo) lentivirusLVP027$350.00
CRE-2A-RFP (CMV, Neo), Concentrated LentivirusLVP027-PBS$650.00
CRE-2A-RFP (CMV, Puro) lentivirusLVP338$350.00
CRE-2A-RFP (CMV, Puro), Concentrated LentivirusLVP338-PBS$650.00
CRE-2A-RFP (EF1a Pro, Bsd) lentivirusLVP522$350.00
CRE-2A-RFP (EF1a Pro, Bsd), Concentrated LentivirusLVP522-PBS$650.00
CRE-2A-RFP (EF1a Pro, Neo) lentivirusLVP524$350.00
CRE-2A-RFP (EF1a Pro, Neo), Concentrated LentivirusLVP524-PBS$650.00
CRE-2A-RFP (EF1a Pro, Puro) Concentrated LentivirusLVP523-PBS$650.00
CRE-2A-RFP (EF1a Pro, Puro) LentivirusLVP523$350.00
Luciferase-2A-CRE (CMV Pro, Puro) LentivirusLVP409$450.00
Luciferase-2A-CRE (CMV Pro, Puro) Concentrated LentivirusLVP409-PBS$800.00
Luciferase-2A-CRE (CMV Pro, Bsd)LVP304$450.00
Luciferase-2A-CRE (CMV Pro, Bsd) Concentrated LentivirusLVP304-PBS$800.00
Luciferase-2A-CRE (CMV Pro, Neo) Concentrated LentivirusLVP410-PBS$800.00
Luciferase-2A-CRE (GFP-Bsd) lentiviral particlesLVP411$450.00
Luciferase-2A-CRE (GFP-Puro) lentiviral particlesLVP412$450.00
Luciferase-2A-CRE (Neo) lentiviral particlesLVP410$450.00
Luciferase-2A-CRE (RFP-Bsd) lentiviral particlesLVP413$450.00
Luciferase-2A-CRE (RFP-Puro) lentiviral particlesLVP414$450.00

    Cart

    Product Selection Guides

    • Luciferase Imaging
    • Fluorescent Markers
    • Sub-cellular Imaging
    • Signal Pathway Assay
    • CRISPR Gene Editing
    • ImmunoOncology Research
    • Cell Immortalization
    • Inducible Expression
    • Reporter Cell Lines
    • Promoter Research
    • iPS Factors

    VIEW MORE

    Stay Connected

    Online Payment Service
  • Home
  • Products
    • Premade Lentivirus
    • Pathway Reporter
    • Cell Immortalization
    • ImmunoOncology Research
    • CRISPR Gene Editing
    • Stable cell lines
    • Cell-Specific Reporter
    • Infectious Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • Adenovirus
    • shRNA lentivirus
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Technology
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Product citations
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News

2008 ~ ©, 2023 GenTarget Inc. All rights reserved.

Contact | Terms | View Cart

Scroll Up