Skip to content

For product queries: Call 1-858-265-6446 or email at info@gentarget.com

| Login / Register | 0 items | $0.00

gentarget inc.

7930 Arjons Drive, Suite B
San Diego, CA 92126
United States

  • Home
  • Products
    • Premade Lentivirus
      • cDNA (ORF) Expression
      • Luciferases Lentivirus
      • Fluorescent Markers
      • Sub-cellular Imaging
      • Nano-Lantern Imaging
      • Cytoskeleton Imaging
      • Unstable GFP
      • near-infrared RFP
      • Fluorescent fusion
      • CRE recombinase
      • CRE, Flp ColorSwtich
      • SEAP Reporter
      • Tet Repressor
      • rtTA Expression
      • lacZ Enzyme
      • iPS stem cell factors
      • Other enzyme
    • Premade AAV Virus
    • Premade Adenovirus
      • Common Markers & Enzymes
      • GFP CFP YFP RFP BFP & Controls
      • iPS Stem Cell Factors
      • ORF Expression
    • Pathway Reporter
      • Androgen Pathway
      • Antioxidant Pathway
      • ATF6 Pathway
      • C/EBP Pathway
      • CD44CR1 Pathway
      • c-Myc Pathway
      • CREB (cAMP-PKA) Pathway
      • E2F Pathway
      • EGR1 Promoter Pathway
      • Estrogen Receptor Pathway
      • FOXO Pathway
      • GATA Pathway
      • Glucocorticoid Pathway
      • Hedgehog Pathway
      • HNF4 Pathway
      • Hypoxia Pathway
      • IRF Pathway
      • JAK-STAT Pathway
      • JNK / AP1 Pathway
      • MAPK/ERK Pathway
      • MEF2 Pathway
      • MTF1 Pathway
      • NFAT Pathway
      • Notch Signal Pathway
      • NFκB Pathway
      • PPAR Pathway
      • Progesterone Pathway
      • RAR Pathway
      • STAT3 Pathway
      • TGF-β Pathway
      • TP53 Pathway
      • Wnt Signal pathway
      • XBP1 Pathway
      • Blue light inducible reporter
      • Heat inducible expression
      • Mitochondrial pH-sensitive probe
      • Signal Pathway Control
    • Cell Immortalization
      • hTERT Expression
      • SV40 Large T antigen
      • Knockdown P53 shRNA Lentivirus
      • Other Immortalization Factors
    • CARs and TCRs
      • CAR-T Lentivirus
      • TCR Lentivirus
      • Cell Antigens & Receptors
    • CRISPR Gene Editing
      • Cas Enzyme Expression
      • Epigenomic: CRISPRi and CRISPRa
      • gRNA Lentivirus
      • CRISPR Repair and KnockIn
      • CRISPR KnockOut
    • Stable cell lines
      • Assay Cell Lines
      • Luciferase cells
      • Fluorescent cells
      • CRE and Flp reporting cells
      • CRE Expression Cells
      • CRISPR ready cell lines
      • TetR stable cells
      • rtTA stable cells
      • Inducible expression cell lines
      • Ion Channel cells
      • LacZ stable cells
      • Other stable cells
    • Cell-Specific Reporter
      • Astrocytes Report
      • B-Cell Reporter
      • Brain Cell Report
      • Cancer Specific Report
      • Endothelial Cell Report
      • Hematopoietic Cell Report
      • Hepatoma Cell Report
      • Kidney Cell Report
      • Leukocytes Report
      • Lung Tissue Report
      • Macrophages Report
      • Megakaryocytes Report
      • Monocytes Report
      • Muscle Cell Report
      • Neuron Report
      • Ovarian Cancer Report
      • Pancreatic Cancer Report
      • Prostate Cell Report
      • Stem Cell Report
    • Infectious Antigens
      • Viral Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
      • Validated shRNA Lentivirus
      • Customized shRNA
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
      • CRISPR gRNA lentivectors
      • shRNA Lentivectors
      • Promoter-less Lentivectors
      • Lentivirus Packaging plasmids
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
      • Optional Inducible Lentiviral System
      • SureTiter™ Lentiviral System
      • Enhanced super CMV promoter
      • InTag™ trans-membrane proteins
      • Fusion in vivo, Eco™ PCR Cloning
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News
Home / Pathway Reporter / FOXO Pathway

FOXO Pathway

1. About FOXO Pathway:

The FOXO (Forkhead box O) signaling pathway is crucial for regulating various cellular processes, including metabolism, cell cycle control, apoptosis, and stress resistance. FOXO protein family bind to specific DNA sequences (FOXO-responsive elements) in the promoters of their target genes to increase transcription. FOXO proteins can act as tumor suppressors by inducing cell cycle arrest and apoptosis. Loss of FOXO function can contribute to tumorigenesis. [Ref1].

2. Lentivirus Detects Foxo Pathway:

GenTarget developed a set of reporting lentivirus to monitor FOXO (PI3K/AKT) signaling pathway activity. Those reporting lentivirus has a luminescent report (Luciferase) or a fluorescent report (GFP), under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of FOXO transcriptional response element (TRE), sequence motif (5′- GTAAACAATTGTTTACGTAAATAA 3′) [Ref 2]. (Please be noted, this specific TRE motif may vary in different biological contexts).

Upon this pathway activated, FOXO is dephosphorylated, translocates to the nucleus and binds to FOXO binding motif in the report’s promoter region, leading to increased expression of the reporter protein (luciferase or GFP). The amount of light produced (luminescence) or GFP fluorescent signal intensity, is proportional to the activity of the FOXO pathway.

3. Structure of the Reporting Lentivirus:

The pathway specific reporting Lentivirus use either firefly-luciferase or GFP signal changes to detect the pathway’s activity.   Those reporting lentivirus also contains a constitutively expressed Puromycin antibiotic selection marker, or a GFP fluorescent selection marker, which makes it easier to select the stably transduced signal reporting cells, via Puromycin killing or GFP sorting respectively. See lentivector core scheme below.

Pathway detection lentivector map scheme

The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of the signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screening of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.

Click the Product Manual (pdf) for all available products for this pathway reporter.

NamePriceSKUBuy
Luc (Puro) Foxo Pathway Lentivirus$790.00LVP1705
GFP (Puro) Foxo Pathway Lentivirus$790.00LVP1706
Luc (GFP) Foxo Pathway Lentivirus$790.00LVP1707

    Cart

    Product Selection Guides

    • Luciferase Imaging
    • Cell Immortalization
    • Signal Pathway Assay
    • cDNA (ORF) Expression
    • CAR-T, TCR and More
    • CRISPR, CRISPRa, CRISPRi
    • Sub-cellular Imaging
    • Reporter Cell Lines
    • Premade Lentivirus
    • Promoter Research
    • Lentivirus & Cell Line Services

    VIEW MORE

    Stay Connected

    Online Payment Service
  • Home
  • Products
    • Premade Lentivirus
    • Premade AAV Virus
    • Premade Adenovirus
    • Pathway Reporter
    • Cell Immortalization
    • CARs and TCRs
    • CRISPR Gene Editing
    • Stable cell lines
    • Cell-Specific Reporter
    • Infectious Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News

2008 ~ ©, 2025 GenTarget Inc. All rights reserved.

Scroll Up