Antioxidant Pathway
Antioxidant Pathway: A major mechanism in the cellular defense against oxidative or electrophilic stress is activation of the Nrf1/Nrf2-antioxidant response signaling pathway, which regulates the expression of genes (antioxidant proteins) involved in protecting cells from oxidative damage.
Nrf2 (NF-E2-related factor 2) is ubiquitously expressed in most tissues and is continuously degraded in the cytosol under normal oxygen conditions via its inhibitor Keap1. Keap1 contains several cysteine residues that act as redox sensors. Upon changes in the cellular oxygen environment, these cysteine residues are oxidised. As a result, Keap1 undergoes a conformational change and releases Nrf2, which is translocated into the nucleus. In the nucleus, Nrf2 forms a heterodimer with small maf proteins and binds to Nrf1/Nrf2 Response Element, antioxidant response element (ARE) that found in the promoter regions of many antioxidant enzymes, including thioredoxin and thioredoxin reductase, up-regulating their expression.
GenTarget developed a set of reporting lentivirus to monitor the transcriptional activity of the antioxidant pathway. Those reporting lentivirus has a luminescent report (Luciferase, Renilla Luc) or a fluorescent report (GFP, RFP) or a secreted SEAP report, under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of Nrf1/Nrf2 Response Element or ” antioxidant response element” (ARE) sequence motif (5′- TCACAGTGACTCAGCAAAATT). When Nrf2 / Nrf1 binds to Nrf2-RE sequence, the downstream reporter is expressed as the result of activation for the minimal promoter. This pathway can be verified by DL-Sulforaphane stimulation.
The luciferase signal can be measured via Luciferase assay. The fluorescent reporter can be detected via its fluorescent signal. The SEAP secreted into cell culture supernatant, which allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.
Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or provides internal reference for virus transduction efficiency when a fluorescent marker is under the RSV promoter. See lentivector core scheme below.
The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of Antioxidant signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.
Click the Product Manual (pdf) for all available products for this pathway reporter.