Skip to content

For product queries: Call 1-858-265-6446 or email at info@gentarget.com

| Login / Register | 0 items | $0.00

gentarget inc.

7930 Arjons Drive, Suite B
San Diego, CA 92126
United States

  • Home
  • Products
    • Premade Lentivirus
      • cDNA (ORF) Expression
      • Luciferases Lentivirus
      • Fluorescent Markers
      • Sub-cellular Imaging
      • Nano-Lantern Imaging
      • Cytoskeleton Imaging
      • Unstable GFP
      • near-infrared RFP
      • Fluorescent fusion
      • CRE recombinase
      • CRE, Flp ColorSwtich
      • SEAP Reporter
      • Tet Repressor
      • rtTA Expression
      • lacZ Enzyme
      • iPS stem cell factors
      • Other enzyme
    • Premade AAV Virus
    • Premade Adenovirus
      • Common Markers & Enzymes
      • GFP CFP YFP RFP BFP & Controls
      • iPS Stem Cell Factors
      • ORF Expression
    • Pathway Reporter
      • Androgen Pathway
      • Antioxidant Pathway
      • ATF6 Pathway
      • C/EBP Pathway
      • CD44CR1 Pathway
      • c-Myc Pathway
      • CREB (cAMP-PKA) Pathway
      • E2F Pathway
      • EGR1 Promoter Pathway
      • Estrogen Receptor Pathway
      • FOXO Pathway
      • GATA Pathway
      • Glucocorticoid Pathway
      • Hedgehog Pathway
      • HNF4 Pathway
      • Hypoxia Pathway
      • IRF Pathway
      • JAK-STAT Pathway
      • JNK / AP1 Pathway
      • MAPK/ERK Pathway
      • MEF2 Pathway
      • MTF1 Pathway
      • NFAT Pathway
      • Notch Signal Pathway
      • NFκB Pathway
      • PPAR Pathway
      • Progesterone Pathway
      • RAR Pathway
      • STAT3 Pathway
      • TGF-β Pathway
      • TP53 Pathway
      • Wnt Signal pathway
      • XBP1 Pathway
      • Blue light inducible reporter
      • Heat inducible expression
      • Mitochondrial pH-sensitive probe
      • Signal Pathway Control
    • Cell Immortalization
      • hTERT Expression
      • SV40 Large T antigen
      • Knockdown P53 shRNA Lentivirus
      • Other Immortalization Factors
    • CARs and TCRs
      • CAR-T Lentivirus
      • TCR Lentivirus
      • Cell Antigens & Receptors
    • CRISPR Gene Editing
      • Cas Enzyme Expression
      • Epigenomic: CRISPRi and CRISPRa
      • gRNA Lentivirus
      • CRISPR Repair and KnockIn
      • CRISPR KnockOut
    • Stable cell lines
      • Assay Cell Lines
      • Luciferase cells
      • Fluorescent cells
      • CRE and Flp reporting cells
      • CRE Expression Cells
      • CRISPR ready cell lines
      • TetR stable cells
      • rtTA stable cells
      • Inducible expression cell lines
      • Ion Channel cells
      • LacZ stable cells
      • Other stable cells
    • Cell-Specific Reporter
      • Astrocytes Report
      • B-Cell Reporter
      • Brain Cell Report
      • Cancer Specific Report
      • Endothelial Cell Report
      • Hematopoietic Cell Report
      • Hepatoma Cell Report
      • Kidney Cell Report
      • Leukocytes Report
      • Lung Tissue Report
      • Macrophages Report
      • Megakaryocytes Report
      • Monocytes Report
      • Muscle Cell Report
      • Neuron Report
      • Ovarian Cancer Report
      • Pancreatic Cancer Report
      • Prostate Cell Report
      • Stem Cell Report
    • Infectious Antigens
      • Viral Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
      • Validated shRNA Lentivirus
      • Customized shRNA
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
      • CRISPR gRNA lentivectors
      • shRNA Lentivectors
      • Promoter-less Lentivectors
      • Lentivirus Packaging plasmids
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
      • Optional Inducible Lentiviral System
      • SureTiter™ Lentiviral System
      • Enhanced super CMV promoter
      • InTag™ trans-membrane proteins
      • Fusion in vivo, Eco™ PCR Cloning
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News
Home / Pathway Reporter / TP53 Pathway

TP53 Pathway

About P53 Signal Pathway:

Tumor protein p53 (TP53) is crossroad of a network of signaling pathways that are essential for cell growth regulation and apoptosis induced by genotoxic and non-genotoxic stresses. The p53 tetramer recognizes specifically a 20-bp DNA of p53 response elements (p53-RE). There are hundreds of experimental verified p53 response elements. The activation of p53 is a two steps process. First p53 protein level is increased via the inhibition of its interaction with mdm2 and the other negative regulators. Second, a series of modulator (kinases, acetylases) will activates p53 transcription. The accumulated P53 binds to p53-RE which regulates downstream target gene expression, resulted in either cell cycle arrest and DNA repair or apoptosis. p53 becomes activated in response to myriad stressors, including but not limited to DNA damage, oxidative stress, osmotic shock, ribonucleotide depletion, and deregulated oncogene expression.

Detect P53 Signal Pathway:

GenTarget developed a set of reporting lentivirus to monitor the activity P53-regulated signal transduction pathways in cultured cells. Those reporting lentivirus has a luminescent report (Luciferase, Renilla Luc) or a fluorescent report (GFP, RFP) or a  secreted SEAP report, under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of a few most potent P53 transcriptional response element (p53-RE) sequence motif (5′- GGGCATGTCCGGGCATGTCC, GAACATGTCCCAACATGTTG, GGACATGCCCGGGCATGTCT). When p53 binds to p53-RE sequence, the downstream reporter is expressed as the result of activation for the minimal promoter. This pathway lentivirus can be verified by stimulation from many chemicals, such as Nutlin (known as MDM-2 antagonist).

The luciferase signal can be measured via Luciferase assay. The fluorescent reporter can be detected via its fluorescent signal. The SEAP secreted into cell culture supernatant, which allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.

Use Report Lentivirus for P53 Signal Pathway:

Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or  provides internal reference for virus transduction efficiency when a fluorescent marker is under the RSV promoter. See lentivector core scheme below.

P53 pathway lentivector

The premade, ready-to-use reporter lentivirus provides a much easier tool to monitor the activity of P53 signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay.

Click the Product Manual (pdf) for all available Products for this pathway reporter.

NameSKUPriceBuy
P53-GFP (Bsd) lentivirusLVP977-B$495.00
P53-GFP (Bsd) lentivirus in PBSLVP977-B-PBS$650.00
P53-GFP (Neo) lentivirusLVP977-N$495.00
P53-GFP (Neo) lentivirus in PBSLVP977-N-PBS$650.00
P53-GFP (Puro) lentivirusLVP977-P$495.00
P53-GFP (Puro) lentivirus in PBSLVP977-P-PBS$650.00
P53-GFP (RFP) lentivirusLVP977-R$495.00
P53-GFP (RFP) lentivirus in PBSLVP977-R-PBS$650.00
P53-Luc (Bsd) lentivirusLVP979-B$495.00
P53-Luc (Bsd) lentivirus in PBSLVP979-B-PBS$650.00
P53-Luc (GFP) lentivirusLVP979-G$495.00
P53-Luc (GFP) lentivirus in PBSLVP979-G-PBS$650.00
P53-Luc (Neo) lentivirusLVP979-N$495.00
P53-Luc (Neo) lentivirus in PBSLVP979-N-PBS$650.00
P53-Luc (Puro) lentivirusLVP979-P$495.00
P53-Luc (Puro) lentivirus in PBSLVP979-P-PBS$650.00
P53-Luc (RFP) lentivirusLVP979-R$495.00
P53-Luc (RFP) lentivirus in PBSLVP979-R-PBS$650.00
P53-RFP (Bsd) lentivirusLVP978-B$495.00
P53-RFP (Bsd) lentivirus in PBSLVP978-B-PBS$650.00
P53-RFP (GFP) lentivirusLVP978-G$495.00
P53-RFP (GFP) lentivirus in PBSLVP978-G-PBS$650.00
P53-RFP (Neo) lentivirusLVP978-N$495.00
P53-RFP (Neo) lentivirus in PBSLVP978-N-PBS$650.00
P53-RFP (Puro) lentivirusLVP978-P$495.00
P53-RFP (Puro) lentivirus in PBSLVP978-P-PBS$650.00
P53-RLuc (Bsd) lentivirusLVP980-B$495.00
P53-RLuc (Bsd) lentivirusLVP980-N$495.00
P53-RLuc (Bsd) lentivirus in PBSLVP980-B-PBS$650.00
P53-RLuc (Bsd) lentivirus in PBSLVP980-N-PBS$650.00
P53-RLuc (GFP) lentivirusLVP980-G$495.00
P53-RLuc (GFP) lentivirus in PBSLVP980-G-PBS$650.00
P53-RLuc (Puro) lentivirusLVP980-P$495.00
P53-RLuc (Puro) lentivirus in PBSLVP980-P-PBS$650.00
P53-RLuc (RFP) lentivirusLVP980-R$495.00
P53-RLuc (RFP) lentivirus in PBSLVP980-R-PBS$650.00
P53-SEAP (Bsd) lentivirusLVP1297$495.00
P53-SEAP (Bsd) lentivirus in PBSLVP1297-PBS$650.00
P53-SEAP (Neo) lentivirusLVP1298$495.00
P53-SEAP (Neo) lentivirus in PBSLVP1298-PBS$650.00
P53-SEAP (Puro) lentivirusLVP1296$495.00
P53-SEAP (Puro) lentivirus in PBSLVP1296-PBS$650.00
P53-SEAP (RFP) lentivirusLVP1299$495.00
P53-SEAP (RFP) lentivirus in PBSLVP1299-PBS$650.00

    Cart

    Product Selection Guides

    • Luciferase Imaging
    • Cell Immortalization
    • Signal Pathway Assay
    • cDNA (ORF) Expression
    • CAR-T, TCR and More
    • CRISPR, CRISPRa, CRISPRi
    • Sub-cellular Imaging
    • Reporter Cell Lines
    • Premade Lentivirus
    • Promoter Research
    • Lentivirus & Cell Line Services

    VIEW MORE

    Stay Connected

    Online Payment Service
  • Home
  • Products
    • Premade Lentivirus
    • Premade AAV Virus
    • Premade Adenovirus
    • Pathway Reporter
    • Cell Immortalization
    • CARs and TCRs
    • CRISPR Gene Editing
    • Stable cell lines
    • Cell-Specific Reporter
    • Infectious Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • shRNA lentivirus
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Product citations
    • Technology
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News

2008 ~ ©, 2025 GenTarget Inc. All rights reserved.

Contact | Terms | View Cart

Scroll Up