Skip to content

For product queries: Call 1-858-678-8683 or email at info@gentarget.com

| Login / Register | 0 items | $0.00

gentarget inc.

7930 Arjons Drive, Suite B
San Diego, CA 92126
United States

  • Home
  • Products
    • Premade Lentivirus
      • cDNA (ORF) Expression
      • Luciferases
      • Fluorescent Markers
      • Cytoskeleton Imaging
      • Sub-cellular Imaging
      • Unstable GFP
      • near-infrared RFP
      • Fluorescent fusion
      • CRE recombinase
      • LoxP GFP/RFP ColorSwtich
      • SEAP Reporter
      • Tet Repressor
      • rtTA Expression
      • lacZ Enzyme
      • iPS stem cell factors
      • Other enzyme
    • Pathway Reporter
      • Androgen Pathway
      • Antioxidant Pathway
      • C/EBP Pathway
      • CD44CR1 Pathway
      • CREB (cAMP-PKA) Pathway
      • EGR1 Promoter Pathway
      • Estrogen Receptor Pathway
      • Glucocorticoid Pathway
      • Hedgehog Pathway
      • Hypoxia Pathway
      • JAK-STAT Pathway
      • JNK / AP1 Pathway
      • MAPK/ERK Pathway
      • Notch Signal Pathway
      • NFκB Pathway
      • TP53 Pathway
      • Wnt Signal pathway
      • Blue light inducible reporter
      • Heat inducible expression
      • Mitochondrial pH-sensitive probe
      • Signal Pathway Control
    • Cell Immortalization
      • hTERT Expression
      • SV40 Large T antigen
      • P53 siRNA Lentivirus
      • Other Immortalization Factors
    • Cell-Specific Reporter
      • Astrocytes Report
      • B-Cell Reporter
      • Brain Cell Report
      • Cancer Specific Report
      • Endothelial Cell Report
      • Hematopoietic Cell Report
      • Hepatoma Cell Report
      • Kidney Cell Report
      • Leukocytes Report
      • Lung Tissue Report
      • Macrophages Report
      • Megakaryocytes Report
      • Monocytes Report
      • Muscle Cell Report
      • Neuron Report
      • Ovarian Cancer Report
      • Pancreatic Cancer Report
      • Prostate Cell Report
      • Stem Cell Report
    • Infectious Antigens
      • Viral Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • CRISPR / CAS9
    • ImmunoTherapy
    • Stable cell lines
      • Pathway Cell Line
      • Luciferase cells
      • Fluorescent cells
      • CRE reporting cells
      • CRE Expression Cells
      • CRISPR ready cell lines
      • TetR stable cells
      • rtTA stable cells
      • Inducible expression cell lines
      • Ion Channel cells
      • LacZ stable cells
      • Other stable cells
    • Adenovirus
      • Common Markers & Enzymes
      • GFP CFP YFP RFP BFP & Controls
      • iPS Stem Cell Factors
      • ORF Expression
    • shRNA lentivirus
      • Validated shRNA Lentivirus
      • Customized shRNA
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
      • CRISPR gRNA lentivectors
      • shRNA Lentivectors
      • Promoter-less Lentivectors
      • Lentivirus Packaging plasmids
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Technology
      • Optional Inducible Lentiviral System
      • SureTiter™ Lentiviral System
      • Enhanced super CMV promoter
      • InTag™ trans-membrane proteins
      • Fusion in vivo, Eco™ PCR Cloning
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Product citations
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News
Home / Pathway Reporter / Androgen Pathway

Androgen Pathway

What is Androgen signaling pathways?

Androgens, mainly testosterone and 5alpha-dihydrotestosterone (DHT) play significant role in the growth and development of the male reproductive organs. These steroid hormones bring about their biological functions through their associations with Androgen receptor (AR, also known as NR3C4). Activated AR upon ligand binding undergoes conformational change to form a homodimer and interacts tightly with the Androgen Response Element (A-RE) which regulates gene expression. Various regulators that regulate androgen induced apoptosis include BRCA1 and Smad3 and Akt, and much more.

How to Detect Androgen pathway?

GenTarget developed a set of reporting lentivirus to monitor Androgen signaling pathway, the transcriptional activity of the androgen receptor. Those reporting lentivirus has a luminescent report (Luciferase, Renilla Luc) or a fluorescent report (GFP, RFP) or a  secreted SEAP report, under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of Androgen Response Element (A-RE) sequence motif (5′- TGGAGGAACATATTGTATTTATT). The luciferase signal can be measured via Luciferase assay. The fluorescent reporter can be detected via its fluorescent signal. The SEAP secreted into cell culture supernatant, which allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.

When androgenic hormones, testosterone or dihydrotestosterone binds to its receptor (AR), it activated the receptor. The activated receptor then binds to A-RE which induce the downstream reporter’s expression as the result of activation for the minimal promoter. The reporter’s signal can be easily and rapidly readout via all types of assays (Reporter assay or by fluorescent microscope or FACS sorter).

Androgen Pathway Report Lentivirus Features:

Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or provides internal reference for virus transduction efficiency. See lentivector core structure map below:

The premade, ready-to-use reporter lentivirus provides an easier, sensitive and quantitative tool to monitor the activity of Androgen signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay. See each product below, or click to see Product Manual for details (.pdf).

NameSKUPriceBuy
AR-GFP (Bsd) lentivirusLVP912-B$495.00
AR-GFP (Bsd) lentivirus in PBSLVP912-B-PBS$650.00
AR-GFP (Neo) lentivirusLVP912-N$495.00
AR-GFP (Neo) lentivirus in PBSLVP912-N-PBS$650.00
AR-GFP (Puro) lentivirusLVP912-P$495.00
AR-GFP (Puro) lentivirus in PBSLVP912-P-PBS$650.00
AR-GFP (RFP) lentivirusLVP912-R$495.00
AR-GFP (RFP) lentivirus in PBSLVP912-R-PBS$650.00
AR-Luciferase (Bsd) lentivirusLVP914-B$495.00
AR-Luciferase (Bsd) lentivirus in PBSLVP914-B-PBS$650.00
AR-Luciferase (GFP) lentivirusLVP914-G$495.00
AR-Luciferase (GFP) lentivirus in PBSLVP914-G-PBS$650.00
AR-Luciferase (Neo) lentivirusLVP914-N$495.00
AR-Luciferase (Neo) lentivirus in PBSLVP914-N-PBS$650.00
AR-Luciferase (Puro) lentivirusLVP914-P$495.00
AR-Luciferase (Puro) lentivirus in PBSLVP914-P-PBS$650.00
AR-Luciferase (RFP) lentivirusLVP914-R$495.00
AR-Luciferase (RFP) lentivirus in PBSLVP914-R-PBS$650.00
AR-RFP (Bsd) lentivirusLVP913-B$495.00
AR-RFP (Bsd) lentivirus in PBSLVP913-B-PBS$650.00
AR-RFP (GFP) lentivirusLVP913-G$495.00
AR-RFP (GFP) lentivirus in PBSLVP913-G-PBS$650.00
AR-RFP (Neo) lentivirusLVP913-N$495.00
AR-RFP (Neo) lentivirus in PBSLVP913-N-PBS$650.00
AR-RFP (Puro) lentivirusLVP913-P$495.00
AR-RFP (Puro) lentivirus in PBSLVP913-P-PBS$650.00
AR-RLuc (Bsd) lentivirusLVP915-B$495.00
AR-RLuc (Bsd) lentivirus in PBSLVP915-B-PBS$650.00
AR-RLuc (GFP) lentivirusLVP915-G$495.00
AR-RLuc (GFP) lentivirus in PBSLVP915-G-PBS$650.00
AR-RLuc (Neo) lentivirusLVP915-N$495.00
AR-RLuc (Neo) lentivirus in PBSLVP915-N-PBS$650.00
AR-RLuc (Puro) lentivirusLVP915-P$495.00
AR-RLuc (Puro) lentivirus in PBSLVP915-P-PBS$650.00
AR-RLuc (RFP) lentivirusLVP915-R$495.00
AR-RLuc (RFP) lentivirus in PBSLVP915-R-PBS$650.00
AR-SEAP (Bsd) lentivirusLVP1241$495.00
AR-SEAP (Bsd) lentivirus in PBSLVP1241-PBS$650.00
AR-SEAP (Neo) lentivirusLVP1242$495.00
AR-SEAP (Neo) lentivirus in PBSLVP1242-PBS$650.00
AR-SEAP (Puro) lentivirusLVP1240$495.00
AR-SEAP (Puro) lentivirus in PBSLVP1240-PBS$650.00
AR-SEAP (RFP) lentivirusLVP1243$495.00
AR-SEAP (RFP) lentivirus in PBSLVP1243-PBS$650.00

    Cart

    Product Selection Guides

    • Luciferase Imaging
    • Fluorescent Markers
    • Sub-cellular Imaging
    • Signal Pathway Assay
    • CRISPR Gene Editing
    • ImmunoTherapy
    • Cell Immortalization
    • Inducible Expression
    • Reporter Cell Lines
    • Promoter Research
    • iPS Factors

    VIEW MORE

    Stay Connected

    Online Payment Service
  • Home
  • Products
    • Premade Lentivirus
    • Pathway Reporter
    • Cell Immortalization
    • Cell-Specific Reporter
    • Infectious Antigens
    • Virus Like Particles (VLP)
    • Non-integrating LV
    • CRISPR / CAS9
    • ImmunoTherapy
    • Stable cell lines
    • Adenovirus
    • shRNA lentivirus
    • microRNA lentivirus
    • anti miRNA lentivirus
    • Lentivectors
    • Control lentivirus
    • Ultra titer lentivirus
    • Eco PCR Cloning Kits
    • Reagents for Lentivirus
  • Services
    • Lentivirus Service
    • Customized Stable Cell Lines
    • Fusion In Vivo PCR Cloning
    • Protein Expression
    • Antibody Cloning and Expression
  • Support
    • Technology
    • Protocols
    • MSDS Files
    • Promotion
    • Product Manuals
    • Vector sequences
    • Product FAQs
    • Product citations
    • Terms
    • Useful Links
  • Distributors
  • About Us
  • Contact
  • News

2008 ~ ©, 2021 GenTarget Inc. All rights reserved.

Contact | Terms | View Cart

Scroll Up