Androgen Pathway

Androgen signaling pathways: Androgens, mainly testosterone and 5alpha-dihydrotestosterone (DHT) play significant role in the growth and development of the male reproductive organs. These steroid hormones bring about their biological functions through their associations with Androgen receptor (AR, also known as NR3C4). Activated AR upon ligand binding undergoes conformational change to form a homodimer and interacts tightly with the Androgen Response Element (A-RE) which regulates gene expression. Various regulators that regulate androgen induced apoptosis include BRCA1 and Smad3 and Akt, and much more.

GenTarget developed a set of reporting lentivirus to monitor Androgen signaling pathway, the transcriptional activity of the androgen receptor. Those reporting lentivirus has a luminescent report or a fluorescent report under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of Androgen Response Element (A-RE) sequence motif (5′- TGGAGGAACATATTGTATTTATT). When androgenic hormones, testosterone or dihydrotestosterone binds to AR, the activated AR binds to ARE which induce the downstream reporter’s expression as the result of activation for the minimal promoter. The reporter’s signal can be easily and rapidly readout via all types of assays (luciferase assay or by fluorescent microscope or FACS sorter).

Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or provides internal reference for virus transduction efficiency. See lentvector core structure map below:

The premade, ready-to-use reporter lentivirus provides an easier, sensitive and quantitative tool to monitor the activity of Androgen signaling pathways in virtually any mammalian cell type. It also allows to generate your own reporting cell line in your desired cell type for study or screen of pathway specific gene-knockdown, over-expression, or chemical / drug/protein treatment in the cell based assay. See each product below, or click to see Product Manual for details (.pdf).