Description
Pre-packaged rAAV in Serotype-DJ, constitutively express nuclear localized CRE Recombinase, under a enhanced CMV Promoter (suCMV), with NLS (Nuclear Localization Sequence)-tag.
CRE Recombinase (click to see its codon sequence), from bacteriophage P1, catalyzes recombination between two LoxP sites (5′- GAAGTTCCTATTCTGTATTTATACGAAGTTAT -3′).
The following scheme showed the AAV vector’s core structure. See Product Manual for details.
AAV Serotype-DJ is a synthetic serotype made from different serotypes using DNA shuffling. AAV-DJ serotype has the enhanced transduction efficiency in vitro and in vivo compared to wild-type serotypes with Broad Cell Tropism, great transduction rate in CNS, Liver, Kidney, Fibroblasts, muscle.
Titer: ~ 1×10^12 GC/mL
Size: 100ul/vial, in stock, ready to ship in overnight Dry-ice package.
Storage Buffer: PBS
CAT#: A18.DJ
