Description
Pre-packaged rAAV in Serotype-DJ, bicistronically and constitutively express nuclear localized CRE recombinase (with N-terminal Nuclear Localization Sequence) and GFP fluorescent dual Reporter, under a the same CMV Promoter, as two individual proteins (not as a fusion), mediated by a 2A element.
CRE Recombinase (click to see its codon sequence), from bacteriophage P1, catalyzes recombination between two LoxP sites (5′- GAAGTTCCTATTCTGTATTTATACGAAGTTAT -3′). GFP fluorescent can be easily detected under F-microscope or FAC machine.
The following scheme showed the AAV vector’s core structure. See Product Manual for details.

AAV Serotype-DJ is a synthetic serotype made from different serotypes using DNA shuffling. AAV-DJ serotype has the enhanced transduction efficiency in vitro and in vivo compared to wild-type serotypes with Broad Cell Tropism, great transduction rate in CNS, Liver, Kidney, Fibroblasts, muscle.
Titer: ~ 1×10^12 GC/mL
Size: 100ul/vial, in stock, ready to ship in overnight Dry-ice package.
Storage Buffer: PBS
CAT#: A19.DJ

