AR-RFP (Neo) lentivirus in PBS



Pre-made lentivirus express RFP reporter under a minimal promoter that embedded with optimized tandem repeats of Androgen Response Element (ARE) sequence motif (5′- TGGAGGAACATATTGTATTTATT). This lentivirus  also contain the Blasticidin selection marker under RSV promoter. See Product Manual for details (.pdf).

If desired, you can also use the Pathway control lentivirus to establish the No-response control profile to your pathway stimulus. The correct pathway control virus is: CAT#: Path-Ctr10

This is concentrated lentivirus provided in PBS solution, used for hard-to-transduced cell types or for serum-free cell culture.

Amount:  200ul/per vial, at 1 x 108 IFU/ml in PBS. 

Cat#: LVP913-N-PBS